BUDDIES

TormakSaber's 176 BUDDIES:
Type-3 Industries: The Lastest in Galatic Warfare
the Québec is too good for maxis
Away for a bit, but I'll be back! :)
When you push the envelope - beware of paper cuts
See My Sporecasts for Favorite Creator Collections
99 quailty building created wait for the 100th
I really wish I could afford the expansion pack...
If you run across my critters in-game let me know!
http://www.youtube.com/user/AnaxymanderGray
Pissin blimey! Theres jam coming outta the walls!
Buddy-List me to add cool, simple creatures =)
I try to be unique.
DNA! Soup of Creation
Altering reality, one abomination at a time.
Life's been good to me so far...
People are still playing this game?
The spice must flow!
A relic from a glorious time.
Quality before quantity.
The only limit is imagination...
Where is your God now?
Life is better in the editor. See for yerself.
I hope you enjoy what you see.
The Universe speaks to those who listen.
New DarkSpore based Floones up!
Creations for Play, Subscribe say Hi :)
right now: inactive
use anything you'd like in any adventure
A collect call from Mal Reynolds? Yes, I'll hold..
Howdoodles :)
I'm addicted to pink spice!
Bringing creatures to life since 2008
Make sure you check out my Sporecasts!
When in doubt. Blame Dairuka.
With our phony British accents, Oho ho ho!
davoonline.com
Purveyor of beautiful abominations.
Dare not meddle within the affairs of we dragons!
Bye, and thank you for coming to my page.
Illars demand a sacrifice.
:+: standing here in my field of dreams :+:
Demented but Determined
Function > form, quality > quantity. Nothing clips
Super Detail + Poor Animation = Lame
Where your needs are never met.
Sporelicious™
Realistic=phooey Personality=yes
My next creation? A planet!
EndoCopper
Altaholicus Infinitus Maximus
i amde a amazing monster itbeeteverythinginitspast
Back and ready to make more weirdness.
Back from a bit of a break!
Use whatever you want
Good to see some old faces ^^
OH THE SPOREMANITY!!!
Don't even worry about it!
change your tagline
Traps. It is, in fact, a trap.
We come in peace! Shoot to kill!
No longer active D:
The creator's handiwork is proved in the stitching
In a tongue twist lie.
What the super-nova was that?!
Above all else: sky.
There can be only one.
Born to Create
It was fun while it lasted.
Always treat your kite like you treat you woman!
Building a world...Bit by Bit
internet access dying... feeling... woozy
All Hail the Caffinated Goodness
I'm baaaaaack
http://ladympire.com/
I'm back... temporarily?
Creator of the Playable Buddylist Project
I'm back.
The Unsleeping One
Progress with new stuff is slow :)
back again?
möglich ist alles, umöglich dauert etwas länger
-(Jellybutton King)- you have no idea...
TRYING TO DO EVERYTHING THE EASY WAY wait oh shi..
Thanks for the memories.... I'm done for now.
Inactive - not responding to comments.
Spore crashes on start-up, not reinstalling
Ralfiolio humpfrood en ralfiolio!
Have fun
Fully Featured Functionality
Boom! Shaka-laka!
Your horrible Sporum moderator
a bit out of practice
Bringer of life and destruction
Engineering the Genome..
Beauty in simplicity.
Play 4 fun its only a game.
The only way to win is not to play...
Critters made with whimsical heart and a wry smile
has been gone for a while, but will be back soon.
GWJ Careful it bites! ------------>
I have a big imagination
deceaseded.
All shall fall to the Void.
Back in Action! How have you all been?
There's no-one here but us rabbits.
http://www.youtube.com/user/DarkEdgeTV
Quality over Quantity
Creating abominations of God since June, 2008
Sorry for no recent updates
I love the smell of Gravity in the morning.
Playing Darwin in my spare time
Hallowed are the SporEye
There's fire in the blood.
Fear the borg.
There is no such thing as "only one kobold".
An entire galaxy in the hands of one spastic herb
Check out my new player ID- Slarti-42
I'm not here anymore, you can use any creation
Dreaming up the craziest critters...
tagtagtagtagtagtagtagtagtagtag
Explore all possibilities.
HOLY COW A MONKEY
Mixing reality and fantasy
Hail to the Sun God he sure is a Fun God RA RA RA
Dear lord I'm rusty at this...
Opp Ack Baby! Learning still.
I eat your babies in the name of science and fun.
Victory is Mine!
To create a better tagline...
Here there be critters... and other things too!
My computer crashed a LONG time ago
>> cReAtiVitY iS My WoRld <<
Youre Whats For Dinner
Spore had much potential. It could yet be realized
change your tagline
Conquering the Universe one step at a time.
Project Zerowear - Creatures to Please