BUDDIES
TormakSaber's 176 BUDDIES:
Away for a bit, but I'll be back! :)
When you push the envelope - beware of paper cuts
See My Sporecasts for Favorite Creator Collections
99 quailty building created wait for the 100th
I really wish I could afford the expansion pack...
If you run across my critters in-game let me know!
http://www.youtube.com/user/AnaxymanderGray
Pissin blimey! Theres jam coming outta the walls!
Semi-Extinct
Buddy-List me to add cool, simple creatures =)
I try to be unique.
Ar scáth a chéile a mhaireann na daoine
People are still playing this game?
I hope you enjoy what you see.
New DarkSpore based Floones up!
Creations for Play, Subscribe say Hi :)
right now: inactive
use anything you'd like in any adventure
Derp.
A collect call from Mal Reynolds? Yes, I'll hold..
Bringing creatures to life since 2008
When in doubt. Blame Dairuka.
With our phony British accents, Oho ho ho!
davoonline.com
Purveyor of beautiful abominations.
Dare not meddle within the affairs of we dragons!
Illars demand a sacrifice.
:+: standing here in my field of dreams :+:
Demented but Determined
Function > form, quality > quantity. Nothing clips
Realistic=phooey Personality=yes
My next creation? A planet!
EndoCopper
Altaholicus Infinitus Maximus
change your tagline
i amde a amazing monster itbeeteverythinginitspast
Back and ready to make more weirdness.
Back from a bit of a break!
Use whatever you want
Don't even worry about it!
change your tagline
Traps. It is, in fact, a trap.
We come in peace! Shoot to kill!
No longer active D:
>:D
The creator's handiwork is proved in the stitching
?!
In a tongue twist lie.
What the super-nova was that?!
Above all else: sky.
Born to Create
It was fun while it lasted.
internet access dying... feeling... woozy
All Hail the Caffinated Goodness
I'm back.
The Unsleeping One
back again?
möglich ist alles, umöglich dauert etwas länger
-(Jellybutton King)- you have no idea...
TRYING TO DO EVERYTHING THE EASY WAY wait oh shi..
Ralfiolio humpfrood en ralfiolio!
Boom! Shaka-laka!
Your horrible Sporum moderator
Engineering the Genome..
Beauty in simplicity.
Play 4 fun its only a game.
The only way to win is not to play...
Critters made with whimsical heart and a wry smile
has been gone for a while, but will be back soon.
In hibernation
All shall fall to the Void.
Back in Action! How have you all been?
There's no-one here but us rabbits.
http://www.youtube.com/user/DarkEdgeTV
Sorry for no recent updates
I love the smell of Gravity in the morning.
Playing Darwin in my spare time
Hallowed are the SporEye
There's fire in the blood.
Fear the borg.
There is no such thing as "only one kobold".
An entire galaxy in the hands of one spastic herb
Check out my new player ID- Slarti-42
I'm not here anymore, you can use any creation
Dreaming up the craziest critters...
tagtagtagtagtagtagtagtagtagtag
Explore all possibilities.
HOLY COW A MONKEY
Mixing reality and fantasy
Dear lord I'm rusty at this...
Opp Ack Baby! Learning still.
I eat your babies in the name of science and fun.
Victory is Mine!
To create a better tagline...
A tiny bit of this, a tiny bit of that
>> cReAtiVitY iS My WoRld <<
Youre Whats For Dinner