BUDDIES

EchoZeero's 151 BUDDIES:
Away for a bit, but I'll be back! :)
See My Sporecasts for Favorite Creator Collections
99 quailty building created wait for the 100th
You are beautiful
No, im not God I just play one in Spore.
new creations now at my youtube page
Korean
One good sporecast for good creations, and its fun
java.lang.NullPointerException
Detail is my business.
If you got the money, honey, we got your disease
change your tagline
I hope you enjoy what you see.
my backpack's got jets
Cleaned out my Sporepedia junk
A collect call from Mal Reynolds? Yes, I'll hold..
The master of my own illusionary world.
Never say something is impossible
On a break from Spore.
Cool, creative, and fun
I Am Become Death, Destroyer of Worlds
Butterflyman
http://www.geocities.com/gemwhite/spore/index.html
Comment on my creatures! I comment back :)
If you copy/modify please remember to give credit
Evolution's One-Stop-Shop
Yeah, it's the same guy.
Men build things, then we die, it's in our DNA.
Illars demand a sacrifice.
All the Realms and Worlds...
Name: Henning / Gender: male / Country: Germany
Always fill your complexity meter! ;)
Follow the next order. Ignore the previous order.
Use my stuff in your adventures. I wanna see'em!
This is where the fish lives.
I don't know what to write here
Flibbity Flabbity Floo
Good to see some old faces ^^
Life, The Universe, Everything!
The best (insert noun) you'll ever know.
Ambrosia is Marshmallow Fluff
Please God not another wolf head...
Love trying to make realistic looking vehicles
http://www.lolcatbible.com
Fantasy and Legend
http://hydroglyph.deviantart.com/
Spores travel the universe in a perpetual motion.
Evolution takes no prisioners
Jarno's InterGalactic Collection of "Stuff"
Abandoned -please search Jdoggle
pentultimate being
New Computer! hope to be back soon.
Superman's freeloading older brother
So long, and thanks for all the fish.
Plant and Marine editors would be nice.
I haz antenna, but don't you grab it. >_<
from the cute to the bizar, always functional ;)
I'm BAAAACK!
change your tagline
The Unsleeping One
Progress with new stuff is slow :)
Rock, Paper, Singularity Cannon!!!
A moose among beavers
Ratings and Comments are greatly appreciated! :)
Thanks for all the comments everyone!
Very very busy...I'm so sorry.
Congealed Weapon
Thanks for the memories.... I'm done for now.
To genius and idiots, and gods in everyone of us.
I'm just a luuurrrve machine!!
[Witty tagline]
done with spore, feel free to use my creatures
This avatar was made for all of you. ------------>
Bring unthinkable horrors into your home today!
is currently playing Spore on and off.
Critters made with whimsical heart and a wry smile
Spore still doesn't work for me after reinstall :/
Proud member of the Playable Buddy List.
Retired Sporer.
The Klown Prince of Creation
Vertebrate Paleontologist (Youtube=Roboraptor1981)
Living in my own little world; You're invited
Still away from Spore.
...hosting HUGE sporecasts
Booyashaka!
Punishment is its own reward...
Not in right now; feel free to use anything
The Universe is Alive
Spore!
My latest creations are all on youtube only
Moved on, may return for expac
change your tagline
http://www.qualityspore.com
Will Wright, I'd like my soul back please.
In space no one can hear you spore.
tagtagtagtagtagtagtagtagtagtag
No longer play Spore. Working hard now.
Dear lord I'm rusty at this...
Feature me now! :P
"Life is Weird."
Working on fixing Spore so I can start creating.:)
Installing Spore on new pc, bbs ;)
Fantabulous, magniflerous, stupendlier!
...
NOT a "Twilight" fan
SPORE is a bitter disappointment.
I still check up on you guys! :P
Creativity! The surpreme power of the idea!
Vegetatious Creations: Fine Creations Since 2008
I'm out... Grab what you need.
Where did he go?
Want a final version of the 2005 Spore GDC Concept
trying to return....
JAPAN, 日本