BUDDIES

EchoZeero's 151 BUDDIES:
Away for a bit, but I'll be back! :)
See My Sporecasts for Favorite Creator Collections
99 quailty building created wait for the 100th
You are beautiful
No, im not God I just play one in Spore.
new hover tank go check it :)
Korean
SporeBots for everyone, including mac users!
Gone with the wind
Detail is my business.
If you got the money, honey, we got your disease
change your tagline
I hope you enjoy what you see.
my backpack's got jets
Cleaned out my Sporepedia junk
A collect call from Mal Reynolds? Yes, I'll hold..
The master of my own illusionary world.
Never say something is impossible
CRS Arc Part 1 has arrived!
Cool, creative, and fun
I Am Become Death, Destroyer of Worlds
Butterflyman
http://www.geocities.com/gemwhite/spore/index.html
Comment on my creatures! I comment back :)
If you copy/modify please remember to give credit
Evolution's One-Stop-Shop
= I am the god of the new world =
Yeah, it's the same guy.
Men build things, then we die, it's in our DNA.
Has creator's block
All the Realms and Worlds...
Name: Henning / Gender: male / Country: Germany
Always fill your complexity meter! ;)
Follow the next order. Ignore the previous order.
Use my stuff in your adventures. I wanna see'em!
This is where the fish lives.
I don't know what to write here
helloooo?
Videos - http://www.youtube.com/user/coldchylde
Life, The Universe, Everything!
The best (insert noun) you'll ever know.
Ambrosia is Marshmallow Fluff
Just adding to my sporecasts...
Love trying to make realistic looking vehicles
http://www.lolcatbible.com
Fantasy and Legend
..sometimes, dead is better.
Spores travel the universe in a perpertual motion.
Evolution takes no prisoners
Jarno's InterGalactic Collection of "Stuff"
Whateva's Cleva
pentultimate being
Don't Mess with Texas!
Superman's freeloading older brother
So long, and thanks for all the fish.
Plant and Marine editors would be nice.
I haz antenna, but don't you grab it. >_<
from the cute to the bizar, always functional ;)
I'm BAAAACK!
Hello, Enjoy my Creations!!
The Unsleeping One
Feel free to use any of my stuff.
Rock, Paper, Singularity Cannon!!!
A moose among beavers
Ratings and Comments are greatly appreciated! :)
Thanks for all the comments everyone!
moaburns@yahoo.com
Congealed Weapon
Do a Barrelroll!
To genius and idiots, and gods in everyone of us.
I'm just a luuurrrve machine!!
[Witty tagline]
it's a good thing I didn't create the universe...
This avatar was made for all of you. ------------>
Bring unthinkable horrors into your home today!
is now playing Diablo II.
Critters made with whimsical heart and a wry smile
is not gone, but is not completely here.
Proud member of the Playable Buddy List.
Retired Sporer.
The Klown Prince of Creation
Vertebrate Paleontologist (Youtube=Roboraptor1981)
Living in my own little world; You're invited
Currently busy - taking a break from Spore.
survival of the fittest is simple when none are...
Booyashaka!
Punishment is its own reward...
Visit my fansite at http://sporeshard.vndv.com!
The Universe is Alive
Spore!
My latest creations are all on youtube only
Moved on, may return for expac
Expect something new!
http://www.qualityspore.com
Will Wright, I'd like my soul back please.
In space no one can hear you spore.
tagtagtagtagtagtagtagtagtagtag
No longer play Spore. Working hard now.
Dear lord I'm rusty at this...
Feature me now! :P
"Life is Weird."
Working on fixing Spore so I can start creating.:)
Fantabulous, magniflerous, stupendlier!
...
NOT a "Twilight" fan
SPORE is a bitter disappointment.
Less Fighters!!! lol (Yeah yeah didzo)
Creativity! The surpreme power of the idea!
Vegetatious Creations: Fine Creations Since 2008
I'm out... Grab what you need.
I don't specialize in anything but rather nothing
JAPAN, 日本